Accession | MI0015037 |
Name | ppy-mir-532 |
similar to following miRCarta precursors | ppy-65-190.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
X:50,535,905-50,535,995 (+) |
miRNA | ppy-miR-532-5p |
miRNA | ppy-miR-532-3p |
Sequence (5' -> 3') (91 nts) |
CGACUUGCUUUCUCUCCUCCAUGCCUUGAGUGUAGGACCGUUGGCAUCUUAAUUACCCUCCCACACCCAAGGCUUGCAGAAGAGCGAGCCU |
MFE | -30.80 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
ppy-mir-532 ppy-mir-188 ppy-mir-500 ppy-mir-362 |
Family | mir-188 (MIPF0000113) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |