| Accession | MI0015030 |
| Name | ppy-mir-523 |
| similar to following miRCarta precursors | ppy-30448.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
19:55,474,120-55,474,206 (+) |
| miRNA | ppy-miR-523 |
| Sequence (5' -> 3') (87 nts) |
UCUCGUGCUGUGACCCUCUAGAGGGAAGCACUUUCUGUCGUCUGAAAGAAAAGAACGCGCUUCCCUAUGGAGGGUUACCCUUUGAGA |
| MFE | -41.20 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (10 precursors) |
ppy-mir-520a
ppy-mir-526b ppy-mir-518b ppy-mir-525 ppy-mir-523 ppy-mir-518f ppy-mir-520b ppy-mir-518e ppy-mir-520c ppy-mir-518c |
| Family | mir-515 (MIPF0000020) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |