| Accession | MI0015028 |
| Name | ppy-mir-521-2 |
| similar to following miRCarta precursors | ppy-974.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
19:55,490,265-55,490,356 (+) |
| miRNA | ppy-miR-521 |
| Sequence (5' -> 3') (92 nts) |
UCUCAGGCUGUGACUCUCCAAAGGGAAGAACUUUCUGUUGUCUAAAAGAAAAGAAAAGAACGCACUUCCCUUUAGAGUGUUACCGUGUGAGA |
| MFE | -36.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (11 precursors) |
ppy-mir-520c
ppy-mir-518c ppy-mir-524 ppy-mir-517a ppy-mir-519d ppy-mir-521-2 ppy-mir-520d ppy-mir-517c-2 ppy-mir-520g ppy-mir-517c-3 ppy-mir-520g |
| Family | mir-515 (MIPF0000020) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |