Accession | MI0015014 |
Name | ppy-mir-519f |
similar to following miRCarta precursors | ppy-30460.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Locations |
19:55,542,821-55,542,903 (+) 19_random:5,107,757-5,107,839 (+) |
miRNA | ppy-miR-519f |
Sequence (5' -> 3') (83 nts) |
AGGCUGUGACCCUCUACAGGGAAGCACUUUCUGUUGUCUGAAAGAAAGGAAAGUGCAUCCUUUUAGAGUGUGACUGUUUGAGA |
MFE | -33.00 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (5 precursors) |
ppy-mir-527
ppy-mir-516a-3 ppy-mir-518a-3 ppy-mir-516a-1 ppy-mir-519f |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |