Accession | MI0015011 |
Name | ppy-mir-518e |
similar to following miRCarta precursors | ppy-30450.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:55,480,152-55,480,238 (+) |
miRNA | ppy-miR-518e |
Sequence (5' -> 3') (87 nts) |
UCUCAGGCUGUGACCCUCUAGAGGGAAGCACUUUCUCUUGUCUAAAAGAAAAGAAAGCGCUUCUCUUUAGAGGAUUACUCUUUGAGA |
MFE | -43.50 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (11 precursors) |
ppy-mir-518b
ppy-mir-525 ppy-mir-523 ppy-mir-518f ppy-mir-520b ppy-mir-518e ppy-mir-520c ppy-mir-518c ppy-mir-524 ppy-mir-517a ppy-mir-519d |
Family | mir-515 (MIPF0000020) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |