| Accession | MI0015001 |
| Name | ppy-mir-516b-1 |
| similar to following miRCarta precursors | ppy-853.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Locations |
19:55,511,421-55,511,510 (+) 19_random:5,394,467-5,394,556 (+) |
| miRNA | ppy-miR-516b |
| Sequence (5' -> 3') (90 nts) |
UCUCAGGCUGUGACCAUCUGGAGGUAAGAAGCACUUUCUGUUUUGUGAAAGAAAAGAAAGUGCUUCCUUUCAGAGGGUUACUCUUUGAGA |
| MFE | -44.00 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (5 precursors) |
ppy-mir-518g
ppy-mir-1283b ppy-mir-516b-1 ppy-mir-520i ppy-mir-520h |
| Family | mir-515 (MIPF0000020) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |