| Accession | MI0014998 |
| Name | ppy-mir-515-2 |
| similar to following miRCarta precursors | ppy-856-930.2 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
19_random:436,298-436,380 (-) |
| miRNA | ppy-miR-515-5p |
| miRNA | ppy-miR-515-3p |
| Sequence (5' -> 3') (83 nts) |
UCUCAUGCAGUCAUUCUCCAAAAGAAAGCACUUUCUGUUGUCUGAAAGCAGAGUGCCUUCUUUUGGAGCGUUACUGUUUGAGA |
| MFE | -40.50 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (4 precursors) |
ppy-mir-520a
ppy-mir-526a-2 ppy-mir-515-2 ppy-mir-519e |
| Family | mir-515 (MIPF0000020) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |