| Accession | MI0014994 |
| Name | ppy-mir-514-1 |
| similar to following miRCarta precursors | ppy-29032.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:147,162,781-147,162,878 (-) |
| miRNA | ppy-miR-514 |
| Sequence (5' -> 3') (98 nts) |
AACAUGUUGUCUGUGGUACCCUACUCUGGAGAGUGGCAAUCAUGUGUAAUUAAAUUUGAUUGACACCUCUGUGAGUAGAGUAACGCAUGACACAUACG |
| MFE | -37.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-510
ppy-mir-514-1 |
| Family | mir-506 (MIPF0000130) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |