Accession | MI0014993 |
Name | ppy-mir-513c |
similar to following miRCarta precursors | ppy-931.1 |
Organism | Pongo abelii |
miRNA | ppy-miR-513c |
Sequence (5' -> 3') (82 nts) |
GUACAGUGCCUUUCACAGGGAGGUGUCAUUUAUGUGAACUAAAAUAUAAAUCUCACCUUUCUGAGAAGAGUAAUGUACAGCA |
MFE | -32.70 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Family | mir-506 (MIPF0000130) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |