| Accession | MI0014971 |
| Name | ppy-mir-498 |
| similar to following miRCarta precursors | ppy-28960.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
19:55,448,578-55,448,701 (+) |
| miRNA | ppy-miR-498 |
| Sequence (5' -> 3') (124 nts) |
AACCCUCCUUGGGAAGUGAAGCUCAGGCUGUGAUUUCAAGCCAGGGGGCGUUUUUCUGUAACUGGAUGAAAAGCACCUCCAGGGCUUGAAGCUCACAGUUUGAGAGCAAUCGUCUAACGAAGUU |
| MFE | -54.40 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (8 precursors) |
ppy-mir-512-1
ppy-mir-512-2 ppy-mir-1323 ppy-mir-498 ppy-mir-520e ppy-mir-515-3 ppy-mir-519e ppy-mir-520f |
| Family | mir-498 (MIPF0000463) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |