| Accession | MI0014966 |
| Name | ppy-mir-493 |
| similar to following miRCarta precursors | ppy-376.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
14:102,415,715-102,415,803 (+) |
| miRNA | ppy-miR-493 |
| Sequence (5' -> 3') (89 nts) |
CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUACUGUGUGCCAGGCCCUGUGCCAG |
| MFE | -47.90 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-493 ppy-mir-337 |
| Family | mir-493 (MIPF0000230) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |