| Accession | MI0014950 |
| Name | ppy-mir-450a-2 |
| similar to following miRCarta precursors | ppy-29404.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
X:133,999,749-133,999,848 (-) |
| miRNA | ppy-miR-450a |
| Sequence (5' -> 3') (100 nts) |
CCAAAGAAAGAUGCUAAACUAUUUUUGCGAUGUGUUCCUAAUACGUAAUAUAAAUGUAUUGGGGACAUUUUGCAUUCAUAGUUUUGUAUCAAUGAUAUGG |
| MFE | -37.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (6 precursors) |
ppy-mir-450b
ppy-mir-450a-1 ppy-mir-450a-2 ppy-mir-542 ppy-mir-503 ppy-mir-424 |
| Family | mir-450 (MIPF0000128) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |