| Accession | MI0014945 |
| Name | ppy-mir-433 |
| similar to following miRCarta precursors | ppy-533.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
14:102,427,266-102,427,358 (+) |
| miRNA | ppy-miR-433 |
| Sequence (5' -> 3') (93 nts) |
CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG |
| MFE | -38.40 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (6 precursors) |
ppy-mir-337
ppy-mir-431 ppy-mir-433 ppy-mir-127 ppy-mir-432 ppy-mir-136 |
| Family | mir-433 (MIPF0000177) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |