Accession | MI0014939 |
Name | ppy-mir-423 |
similar to following miRCarta precursors | ppy-141-100.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
17:24,902,242-24,902,331 (+) |
miRNA | ppy-miR-423-5p |
miRNA | ppy-miR-423-3p |
Sequence (5' -> 3') (90 nts) |
AGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUACCCCGCGC |
MFE | -48.50 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-423 |
Family | mir-423 (MIPF0000329) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |