| Accession | MI0014913 |
| Name | ppy-mir-367 |
| similar to following miRCarta precursors | ppy-24446.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
4:117,393,857-117,393,924 (-) |
| miRNA | ppy-miR-367 |
| Sequence (5' -> 3') (68 nts) |
CCAUUACUGUUGCUAAUAUGCAACUCUGUUUAAUAUAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGG |
| MFE | -29.10 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (4 precursors) |
ppy-mir-367 ppy-mir-302d ppy-mir-302c ppy-mir-302b |
| Family | mir-367 (MIPF0000162) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |