Accession | MI0014912 |
Name | ppy-mir-365-2 |
similar to following miRCarta precursors | ppy-175.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
17:26,416,769-26,416,879 (+) |
miRNA | ppy-miR-365 |
Sequence (5' -> 3') (111 nts) |
AGAGUGUUCAAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCGGG |
MFE | -38.40 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-365-2 |
Family | mir-365 (MIPF0000061) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |