Accession | MI0014901 |
Name | ppy-mir-337 |
similar to following miRCarta precursors | ppy-900-276.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
14:102,419,848-102,419,940 (+) |
miRNA | ppy-miR-337-5p |
miRNA | ppy-miR-337-3p |
Sequence (5' -> 3') (93 nts) |
GUAGUCAGUAGUUGGGGGGUGGGAACGGCUUCAUACAGGAGUUGAUGCACAGUUAUCCAGCUCCUAUAUGAUGCCUUUCUUCAUCCCCUUCAA |
MFE | -40.40 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (5 precursors) |
ppy-mir-493
ppy-mir-337 ppy-mir-431 ppy-mir-433 ppy-mir-127 |
Family | mir-337 (MIPF0000195) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |