| Accession | MI0014900 |
| Name | ppy-mir-335 |
| similar to following miRCarta precursors | ppy-249.1 ppy-249.2 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Locations |
7:127,452,363-127,452,454 (+) 7:127,454,360-127,454,451 (+) |
| miRNA | ppy-miR-335 |
| Sequence (5' -> 3') (92 nts) |
UUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA |
| MFE | -40.20 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-335 ppy-mir-335 |
| Family | mir-335 (MIPF0000196) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |