| Accession | MI0014881 |
| Name | ppy-mir-302c |
| similar to following miRCarta precursors | ppy-845.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
4:117,394,361-117,394,428 (-) |
| miRNA | ppy-miR-302c |
| Sequence (5' -> 3') (68 nts) |
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGUAAGUGCUUCCAUGUUUCAGUGGAGG |
| MFE | -31.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (4 precursors) |
ppy-mir-367
ppy-mir-302d ppy-mir-302c ppy-mir-302b |
| Family | mir-302 (MIPF0000071) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |