Accession | MI0014880 |
Name | ppy-mir-302b |
similar to following miRCarta precursors | ppy-835.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
4:117,394,496-117,394,571 (-) |
miRNA | ppy-miR-302b |
Sequence (5' -> 3') (76 nts) |
GCUCCCUUCAACUUUAACAUGGAAGUGCUUUCUGUGACUUUAAAAGAAGUAAGUGCUUCCAUGUUUUAGUAGGAGU |
MFE | -28.70 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (4 precursors) |
ppy-mir-367
ppy-mir-302d ppy-mir-302c ppy-mir-302b |
Family | mir-302 (MIPF0000071) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |