| Accession | MI0014876 |
| Name | ppy-mir-298 |
| similar to following miRCarta precursors | ppy-30462.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
20:56,914,694-56,914,781 (-) |
| miRNA | ppy-miR-298 |
| Sequence (5' -> 3') (88 nts) |
UCAGGUCUUCAGCAGAAGCAGGGCGGUUCUCCCAGUGGUUUUCCUUGACUGUGAGGAACUAGCCUGCUGCUUUGCUCAGGAGUGAGCU |
| MFE | -33.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-296
ppy-mir-298 |
| Family | mir-298 (MIPF0000206) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |