Accession | MI0014854 |
Name | ppy-mir-192 |
similar to following miRCarta precursors | ppy-59.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
11:11,059,354-11,059,463 (+) |
miRNA | ppy-miR-192 |
Sequence (5' -> 3') (110 nts) |
GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC |
MFE | -38.80 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-192 |
Family | mir-192 (MIPF0000063) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |