Accession | MI0014846 |
Name | ppy-mir-181c |
similar to following miRCarta precursors | ppy-165.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:13,988,167-13,988,276 (+) |
miRNA | ppy-miR-181c |
Sequence (5' -> 3') (110 nts) |
CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGGCAAACCAUCGACCGUUGAGUGGACCCUGAGACCUGGAAUUGCCAUCCU |
MFE | -45.70 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-mir-181c ppy-mir-181d |
Family | mir-181 (MIPF0000007) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |