Accession | MI0014817 |
Name | ppy-mir-125a |
similar to following miRCarta precursors | ppy-63-333.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
19:53,227,066-53,227,151 (+) |
miRNA | ppy-miR-125a-5p |
miRNA | ppy-miR-125a-3p |
Sequence (5' -> 3') (86 nts) |
UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC |
MFE | -44.20 kcal/mol |
first miRBase version | 15.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-let-7e
ppy-mir-125a |
Family | mir-10 (MIPF0000033) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |