| Accession | MI0014782 |
| Name | ppy-let-7b |
| similar to following miRCarta precursors | ppy-14.1 |
| potential naming conflicts with | ppy-let-7b (MIMAT0015722) |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
22:41,541,671-41,541,753 (+) |
| miRNA | ppy-let-7b |
| Sequence (5' -> 3') (83 nts) |
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCAGAAGAUAACUAUACAACCUACUGCCUUCCCUG |
| MFE | -46.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-let-7a-3
ppy-let-7b |
| Family | let-7 (MIPF0000002) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |