| Accession | MI0014251 | ||||
| Name | hsa-mir-514b | ||||
| similar to following miRCarta precursors | hsa-963-1141.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:147,250,151-147,250,230 (-) |
||||
| miRNA | hsa-miR-514b-5p | ||||
| miRNA | hsa-miR-514b-3p | ||||
| Sequence (5' -> 3') (80 nts) |
CAUGUGGUACUCUUCUCAAGAGGGAGGCAAUCAUGUGUAAUUAGAUAUGAUUGACACCUCUGUGAGUGGAGUAACACAUG | ||||
| MFE | -38.60 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-514b hsa-mir-509-2 hsa-mir-509-3 |
||||
| Family | mir-506 (MIPF0000130) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Stark et al. | PLoS ONE | 2010 | 20300190 | Characterization of the Melanoma miRNAome by Deep Sequencing. |
| 2 | Witten et al. | BMC Biol. | 2010 | 20459774 | Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. |
| 3 | Creighton et al. | PLoS ONE | 2010 | 20224791 | Discovery of novel microRNAs in female reproductive tract using next generation sequencing. |
| 4 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |