| Accession | MI0014249 | ||||||
| Name | hsa-mir-3200 | ||||||
| similar to following miRCarta precursors | hsa-1023-355.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr22:30,731,557-30,731,641 (+) |
||||||
| miRNA | hsa-miR-3200-5p | ||||||
| miRNA | hsa-miR-3200-3p | ||||||
| Sequence (5' -> 3') (85 nts) |
GGUGGUCGAGGGAAUCUGAGAAGGCGCACAAGGUUUGUGUCCAAUACAGUCCACACCUUGCGCUACUCAGGUCUGCUCGUGCCCU | ||||||
| MFE | -32.10 kcal/mol | ||||||
| first miRBase version | 15.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-3200 |
||||||
| Family | mir-3200 (MIPF0001441) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Stark et al. | PLoS ONE | 2010 | 20300190 | Characterization of the Melanoma miRNAome by Deep Sequencing. |
| 2 | Witten et al. | BMC Biol. | 2010 | 20459774 | Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls. |
| 3 | Hansen et al. | PLoS ONE | 2010 | 20532037 | Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes. |
| 4 | Creighton et al. | PLoS ONE | 2010 | 20224791 | Discovery of novel microRNAs in female reproductive tract using next generation sequencing. |
| 5 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |