Accession | MI0014151 | ||||
Name | hsa-mir-3131 | ||||
similar to following miRCarta precursors | hsa-1057.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr2:219,058,688-219,058,750 (-) |
||||
miRNA | hsa-miR-3131 | ||||
Sequence (5' -> 3') (63 nts) |
GAGUCGAGGACUGGUGGAAGGGCCUUUCCCCUCAGACCAAGGCCCUGGCCCCAGCUUCUUCUC | ||||
MFE | -29.80 kcal/mol | ||||
first miRBase version | 15.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-3131 |
||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Stark et al. | PLoS ONE | 2010 | 20300190 | Characterization of the Melanoma miRNAome by Deep Sequencing. |
2 | Persson et al. | Cancer Res. | 2011 | 21199797 | Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. |