Accession | MI0013570 | ||||
Name | cqu-let-7 | ||||
similar to following miRCarta precursors | cqu-41715-41714.1 | ||||
potential naming conflicts with | cqu-let-7-5p (MIMAT0014366) | ||||
Organism | Culex quinquefasciatus | ||||
Genome | CpipJ1 | ||||
Location |
supercont3.4:280,595-280,685 (+) |
||||
miRNA | cqu-let-7-5p | ||||
miRNA | cqu-let-7-3p | ||||
Sequence (5' -> 3') (91 nts) |
UCGCUGCUCCCACGUUGAGGUAGUUGGUUGUAUAGUAUUAAAAAUUCAAUAUCUACUAUGCAAUCCGCUAGCUUAACUUGUGAGGGCGCCU | ||||
MFE | -35.60 kcal/mol | ||||
first miRBase version | 15.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
cqu-mir-100
cqu-let-7 cqu-mir-125 |
||||
Family | let-7 (MIPF0000002) | ||||
Experiments |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Skalsky et al. | BMC Genomics | 2010 | 20167119 | Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus. |