| Accession | MI0013528 | ||||
| Name | aae-mir-9a-1 | ||||
| similar to following miRCarta precursors | aae-105.1 aae-105.2 | ||||
| Organism | Aedes aegypti | ||||
| Genome | AaegL1 | ||||
| Location |
supercont1.517:555,107-555,187 (+) |
||||
| miRNA | aae-miR-9a | ||||
| Sequence (5' -> 3') (81 nts) |
GUCAAAGUUCUCUUUGGUUAUCUAGCUGUAUGAGUGAAUUUAGAACAUCAUAAAGCUAGCAUACCGAAGUUAAUAGUUGAC | ||||
| MFE | -26.10 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
aae-mir-9a-1 |
||||
| Family | mir-9 (MIPF0000014) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Li et al. | BMC Genomics | 2009 | 19961592 | Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs. |