| Accession | MI0013135 | ||||
| Name | ssc-mir-424 | ||||
| similar to following miRCarta precursors | ssc-34501-305.1 | ||||
| Organism | Sus scrofa | ||||
| miRNA | ssc-miR-424-5p | ||||
| miRNA | ssc-miR-424-3p | ||||
| Sequence (5' -> 3') (80 nts) |
UCCGAGGGGAUGCAGCAGCAAUUCAUGUUUUGAAGGGCUUUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGC | ||||
| MFE | -39.80 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-322 (MIPF0000164) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |