| Accession | MI0013106 | ||||||
| Name | ssc-mir-181a-2 | ||||||
| similar to following miRCarta precursors | ssc-32.1 | ||||||
| Organism | Sus scrofa | ||||||
| Genome | Sscrofa10.2 | ||||||
| Location |
chr1:299,322,152-299,322,231 (+) |
||||||
| miRNA | ssc-miR-181a | ||||||
| Sequence (5' -> 3') (80 nts) |
ACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACCGACCGUUGACUGUACCUUGGGGUUCUU | ||||||
| MFE | -38.50 kcal/mol | ||||||
| first miRBase version | 15.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
ssc-mir-181a-2 ssc-mir-181b-2 |
||||||
| Family | mir-181 (MIPF0000007) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 2 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 4 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |