| Accession | MI0014798 |
| Name | ppy-mir-26a-2 |
| similar to following miRCarta precursors | ppy-33.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
12:57,656,729-57,656,812 (-) |
| miRNA | ppy-miR-26a |
| Sequence (5' -> 3') (84 nts) |
GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCU |
| MFE | -41.30 kcal/mol |
| first miRBase version | 15.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
ppy-mir-26a-2 |
| Family | mir-26 (MIPF0000043) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Brameier et al. | BMC Res Notes | 2010 | 20214803 | Genome-wide comparative analysis of microRNAs in three non-human primates. |