| Accession | MI0013111 | ||||
| Name | ssc-mir-24-2 | ||||
| similar to following miRCarta precursors | ssc-283-35.1 | ||||
| Organism | Sus scrofa | ||||
| Genome | Sscrofa10.2 | ||||
| Location |
chr10:31,340,334-31,340,413 (-) |
||||
| miRNA | ssc-miR-24-2-5p | ||||
| miRNA | ssc-miR-24-3p | ||||
| Sequence (5' -> 3') (80 nts) |
GACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGA | ||||
| MFE | -27.90 kcal/mol | ||||
| first miRBase version | 15.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
ssc-mir-24-2 ssc-mir-27b ssc-mir-23b |
||||
| Family | mir-24 (MIPF0000041) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 2 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 4 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |