| Accession | MI0012922 | ||||
| Name | eca-mir-199b | ||||
| similar to following miRCarta precursors | eca-155-47.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr25:31,553,692-31,553,760 (-) |
||||
| miRNA | eca-miR-199b-5p | ||||
| miRNA | eca-miR-199b-3p | ||||
| Sequence (5' -> 3') (69 nts) |
GUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGC | ||||
| MFE | -27.90 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
eca-mir-199b |
||||
| Family | mir-199 (MIPF0000040) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |