| Accession | MI0012947 | ||||
| Name | eca-mir-18b | ||||
| similar to following miRCarta precursors | eca-542.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chrX:106,692,551-106,692,609 (-) |
||||
| miRNA | eca-miR-18b | ||||
| Sequence (5' -> 3') (59 nts) |
UAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGCCCCU | ||||
| MFE | -16.10 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
eca-mir-363
eca-mir-92a-2 eca-mir-19b-2 eca-mir-20b eca-mir-18b eca-mir-106a |
||||
| Family | mir-17 (MIPF0000001) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |