Accession | MI0012925 | ||||
Name | eca-let-7c | ||||
similar to following miRCarta precursors | eca-37.1 | ||||
potential naming conflicts with | eca-let-7c (MIMAT0013181) | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr26:15,509,722-15,509,792 (+) |
||||
miRNA | eca-let-7c | ||||
Sequence (5' -> 3') (71 nts) |
GGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCU | ||||
MFE | -24.20 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
eca-mir-99a-2
eca-let-7c |
||||
Family | let-7 (MIPF0000002) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |