Accession | MI0012911 | ||||
Name | eca-mir-541 | ||||
similar to following miRCarta precursors | eca-29350.1 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr24:42,934,714-42,934,797 (+) |
||||
miRNA | eca-miR-541 | ||||
Sequence (5' -> 3') (84 nts) |
ACGUCAGGGAAAGGAUUCUGCUGUCGGUCCCACUCCAGAGUUCGCAAAAUGGGUGGUGGGCACAGAAUCCAGUCUCUGCUUGUG | ||||
MFE | -34.00 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (13 precursors) |
eca-mir-382
eca-mir-134 eca-mir-485 eca-mir-154a eca-mir-154b eca-mir-496 eca-mir-377 eca-mir-541 eca-mir-409 eca-mir-412 eca-mir-369 eca-mir-410 eca-mir-656 |
||||
Family | mir-541 (MIPF0000213) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |