| Accession | MI0012906 | ||||
| Name | eca-mir-493b | ||||
| similar to following miRCarta precursors | eca-29339.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr24:42,729,572-42,729,660 (+) |
||||
| miRNA | eca-miR-493b | ||||
| Sequence (5' -> 3') (89 nts) |
CUGGCCUCCAGGGCCUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUUCCGUGUGCCAGGCUCUGUGCCAG | ||||
| MFE | -45.80 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
eca-mir-493b eca-mir-337 |
||||
| Family | mir-493 (MIPF0000230) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |