| Accession | MI0012901 | ||||
| Name | eca-mir-432 | ||||
| similar to following miRCarta precursors | eca-327.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr24:42,748,485-42,748,573 (+) |
||||
| miRNA | eca-miR-432 | ||||
| Sequence (5' -> 3') (89 nts) |
UGCGUGACUCCUCCAGGUCUUGGAGUAGGUCAUUGGGUGGAUCCUUUAUUUCCCUAUGUGGGCCACUGGAUGGCUCCUCCAUGUCUUGG | ||||
| MFE | -33.50 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
eca-mir-337
eca-mir-431 eca-mir-433 eca-mir-127 eca-mir-432 eca-mir-136 |
||||
| Family | mir-432 (MIPF0000211) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |