| Accession | MI0012899 | ||||
| Name | eca-mir-412 | ||||
| similar to following miRCarta precursors | eca-29351.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr24:42,935,784-42,935,863 (+) |
||||
| miRNA | eca-miR-412 | ||||
| Sequence (5' -> 3') (80 nts) |
GGGUACAGGAGGGAUGGUCGACCAGUUGGAAAGUAAUUGUUUCUAAUGUACUUCACCUGGUCCACUAGCCGUCCGUACCC | ||||
| MFE | -35.30 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (11 precursors) |
eca-mir-485
eca-mir-154a eca-mir-154b eca-mir-496 eca-mir-377 eca-mir-541 eca-mir-409 eca-mir-412 eca-mir-369 eca-mir-410 eca-mir-656 |
||||
| Family | mir-412 (MIPF0000192) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |