| Accession | MI0012890 | ||||
| Name | eca-mir-376c | ||||
| similar to following miRCarta precursors | eca-384.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr24:42,911,104-42,911,169 (+) |
||||
| miRNA | eca-miR-376c | ||||
| Sequence (5' -> 3') (66 nts) |
AAAAGGUGGAUAUUCCUUCUAUGUUUAUGUUGUUUAUGGUUAAACAUAGAGGAAAUUCCACGUUUU | ||||
| MFE | -24.90 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (15 precursors) |
eca-mir-494
eca-mir-1193 eca-mir-543 eca-mir-495 eca-mir-3958 eca-mir-376c eca-mir-376b eca-mir-376a eca-mir-1185 eca-mir-381 eca-mir-487b eca-mir-539 eca-mir-889 eca-mir-544-2 eca-mir-655 |
||||
| Family | mir-368 (MIPF0000091) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |