Accession | MI0012876 | ||||
Name | eca-mir-127 | ||||
similar to following miRCarta precursors | eca-80.1 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr24:42,747,005-42,747,074 (+) |
||||
miRNA | eca-miR-127 | ||||
Sequence (5' -> 3') (70 nts) |
CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG | ||||
MFE | -35.10 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
eca-mir-337
eca-mir-431 eca-mir-433 eca-mir-127 eca-mir-432 eca-mir-136 |
||||
Family | mir-127 (MIPF0000080) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |