| Accession | MI0012875 | ||||
| Name | eca-mir-1197 | ||||
| similar to following miRCarta precursors | eca-29342.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr24:42,898,113-42,898,232 (+) |
||||
| miRNA | eca-miR-1197 | ||||
| Sequence (5' -> 3') (120 nts) |
GGGAGAGAGGCUGGGUCAGCGUCACUUCAUGGUAUUUGAAGAUGCGGUUGACCAUGCUGUGUACGCUUUAUUUAUGACGUAGGACACAUGGUCUACUUCUCCUCAAUAUCACAUCUCGCC | ||||
| MFE | -35.00 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (14 precursors) |
eca-mir-379
eca-mir-411 eca-mir-299 eca-mir-380 eca-mir-1197 eca-mir-323 eca-mir-758 eca-mir-329a eca-mir-329b eca-mir-494 eca-mir-1193 eca-mir-543 eca-mir-495 eca-mir-3958 |
||||
| Family | mir-379 (MIPF0000126) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |