Accession | MI0012873 | ||||
Name | eca-mir-1185 | ||||
similar to following miRCarta precursors | eca-927.1 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr24:42,914,351-42,914,436 (+) |
||||
miRNA | eca-miR-1185 | ||||
Sequence (5' -> 3') (86 nts) |
UUUGGUACUUGAAGAGAGGAUACCCUUUGUAUGUUCACUUCAUUAAUGACGAAUAUACAGGGGGAGACUCUUAUUUGCGUAUCAAA | ||||
MFE | -32.00 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (14 precursors) |
eca-mir-495
eca-mir-3958 eca-mir-376c eca-mir-376b eca-mir-376a eca-mir-1185 eca-mir-381 eca-mir-487b eca-mir-539 eca-mir-889 eca-mir-544-2 eca-mir-655 eca-mir-3959 eca-mir-487a |
||||
Family | mir-154 (MIPF0000018) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |