| Accession | MI0012933 | ||||
| Name | eca-mir-135a-2 | ||||
| similar to following miRCarta precursors | eca-517.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr28:22,270,398-22,270,497 (+) |
||||
| miRNA | eca-miR-135a | ||||
| Sequence (5' -> 3') (100 nts) |
AGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAAAUACAUUGUGAAAAAUCA | ||||
| MFE | -34.00 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
eca-mir-135a-2 |
||||
| Family | mir-135 (MIPF0000028) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |