| Accession | MI0012820 | ||||
| Name | eca-let-7g | ||||
| similar to following miRCarta precursors | eca-58.1 | ||||
| potential naming conflicts with | eca-let-7g (MIMAT0013075) | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr16:35,442,180-35,442,267 (+) |
||||
| miRNA | eca-let-7g | ||||
| Sequence (5' -> 3') (88 nts) |
CCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGG | ||||
| MFE | -40.20 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
eca-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |