Accession | MI0012783 | ||||
Name | eca-mir-365-1 | ||||
similar to following miRCarta precursors | eca-175.1 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr11:40,795,086-40,795,151 (-) |
||||
miRNA | eca-miR-365 | ||||
Sequence (5' -> 3') (66 nts) |
AAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUU | ||||
MFE | -25.10 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
eca-mir-365-1 |
||||
Family | mir-365 (MIPF0000061) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |