| Accession | MI0012759 | ||||
| Name | eca-let-7e | ||||
| similar to following miRCarta precursors | eca-50.1 | ||||
| potential naming conflicts with | eca-let-7e (MIMAT0013007) | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr10:21,371,067-21,371,145 (+) |
||||
| miRNA | eca-let-7e | ||||
| Sequence (5' -> 3') (79 nts) |
CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCACGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG | ||||
| MFE | -36.70 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
eca-mir-99b
eca-let-7e eca-mir-125a |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |