Accession | MI0012826 | ||||
Name | eca-mir-26a-2 | ||||
similar to following miRCarta precursors | eca-34.1 | ||||
Organism | Equus caballus | ||||
Genome | Equ Cab 2 | ||||
Location |
chr16:47,241,013-47,241,089 (-) |
||||
miRNA | eca-miR-26a | ||||
Sequence (5' -> 3') (77 nts) |
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGCGGACGC | ||||
MFE | -33.70 kcal/mol | ||||
first miRBase version | 14.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
eca-mir-26a-2 |
||||
Family | mir-26 (MIPF0000043) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |